Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4834873
End position: 4834899
Length: 27

DNA sequence
>NC_018289, from 4834873 to 4834899 (27 bp); Mycobacterium smegmatis str. MC2 155 GCTTGCTTGTCTTGCTTGTCTTGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4834852-4836717	Sequence	MSMEI_4617 - pe-PPE, C-terminal domain protein (Protein is coded in complementary strand; from 4836717 to 4834852)