Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5015703
End position: 5015729
Length: 27

DNA sequence
>NC_018289, from 5015703 to 5015729 (27 bp); Mycobacterium smegmatis str. MC2 155 TCGAAGAGCTCGAAGAGCTCGATGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5015646-5016536	Sequence	MSMEI_4791 - Thioredoxin (Protein is coded in complementary strand; from 5016536 to 5015646)