Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5138510
End position: 5138536
Length: 27

DNA sequence
>NC_018289, from 5138510 to 5138536 (27 bp); Mycobacterium smegmatis str. MC2 155 CGGTCGCCGCGGTCGTCGCGGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5138183-5139928	Sequence	MSMEI_4915 deaD Cold-shock DEAD-box RNA helicase (Protein is coded in complementary strand; from 5139928 to 5138183)