Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5209793
End position: 5209819
Length: 27

DNA sequence
>NC_018289, from 5209793 to 5209819 (27 bp); Mycobacterium smegmatis str. MC2 155 CGGGCTCGGCGGGCTCGGCGGGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5208970-5210727	Sequence	MSMEI_4978 - hypothetical protein (Protein is coded in complementary strand; from 5210727 to 5208970)