Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5307179
End position: 5307205
Length: 27

DNA sequence
>NC_018289, from 5307179 to 5307205 (27 bp); Mycobacterium smegmatis str. MC2 155 AGCACCGCGAGCACCACGACCACCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5306759-5307337	Sequence	MSMEI_5072 - MCE associated membrane protein (Protein is coded in complementary strand; from 5307337 to 5306759)