Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5989306
End position: 5989332
Length: 27

DNA sequence
>NC_018289, from 5989306 to 5989332 (27 bp); Mycobacterium smegmatis str. MC2 155 CCTGGAGGCCCTGGAGGCCCGGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5988238-5989767	Sequence	MSMEI_5768 - spore coat protein CotH (Protein is coded in complementary strand; from 5989767 to 5988238)