Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 610084
End position: 610110
Length: 27

DNA sequence
>NC_018289, from 610084 to 610110 (27 bp); Mycobacterium smegmatis str. MC2 155 GGTCGCCACGGTCGCCGCGGTGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 609107-612553	Sequence	MSMEI_0514 pknK serine/threonine-protein kinase transcriptional regulatory protein PknK (Protein is coded in complementary strand; from 612553 to 609107)