Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6502790
End position: 6502816
Length: 27

DNA sequence
>NC_018289, from 6502790 to 6502816 (27 bp); Mycobacterium smegmatis str. MC2 155 GGTCGGCTTGGTGGGCTTGGTGGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6502182-6503402	Sequence	MSMEI_6265 - hypothetical protein (Protein is coded in complementary strand; from 6503402 to 6502182)