Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6555832
End position: 6555858
Length: 27

DNA sequence
>NC_018289, from 6555832 to 6555858 (27 bp); Mycobacterium smegmatis str. MC2 155 CCGGTGGTCCCGGTGGTCCCGGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6554362-6555891	Sequence	MSMEI_6319 - aldehyde dehydrogenase (Protein is coded in complementary strand; from 6555891 to 6554362)