Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6832524
End position: 6832550
Length: 27

DNA sequence
>NC_018289, from 6832524 to 6832550 (27 bp); Mycobacterium smegmatis str. MC2 155 GGAGTCGGTGGACTCGGTGGAGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6830854-6832704	Sequence	MSMEI_6599 - hypothetical protein (Protein is coded in complementary strand; from 6832704 to 6830854)