Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6987368
End position: 6987394
Length: 27

DNA sequence
>NC_018289, from 6987368 to 6987394 (27 bp); Mycobacterium smegmatis str. MC2 155 TCGCCGTCATCGCCGTCATCGCCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6987128-6987520	Sequence	MSMEI_6751 rnpA ribonuclease P protein component (Protein is coded in complementary strand; from 6987520 to 6987128)