Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 954405
End position: 954431
Length: 27

DNA sequence
>NC_018289, from 954405 to 954431 (27 bp); Mycobacterium smegmatis str. MC2 155 CCGTTGCCGCCGTTGCCGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 953199-957023	Sequence	MSMEI_0848 - hypothetical protein (Protein is coded in complementary strand; from 957023 to 953199)