Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1029196
End position: 1029225
Length: 30

DNA sequence
>NC_018289, from 1029196 to 1029225 (30 bp); Mycobacterium smegmatis str. MC2 155 TCAGCGAATGTCAGCGAAGGTCAGCGAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1029217-1030146	Sequence	MSMEI_0925 - HAD-superfamily hydrolase (Protein is coded in complementary strand; from 1030146 to 1029217)