Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1779808
End position: 1779837
Length: 30

DNA sequence
>NC_018289, from 1779808 to 1779837 (30 bp); Mycobacterium smegmatis str. MC2 155 CGTCGGTGTCGGCTTCGGTGTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1779192-1780487	Sequence	MSMEI_1644 - hypothetical protein (Protein is coded in complementary strand; from 1780487 to 1779192)