Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3952931
End position: 3952960
Length: 30

DNA sequence
>NC_018289, from 3952931 to 3952960 (30 bp); Mycobacterium smegmatis str. MC2 155 CGCCGCGGCGCACCGCGGTGTGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3952159-3953343	Sequence	MSMEI_3788 cobL precorrin-6Y C5,15-methyltransferase CobL (Protein is coded in complementary strand; from 3953343 to 3952159)