Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5349155
End position: 5349184
Length: 30

DNA sequence
>NC_018289, from 5349155 to 5349184 (30 bp); Mycobacterium smegmatis str. MC2 155 CGGGCTCCTCAGGGCTCCTCGGTGCTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5348746-5349210	Sequence	MSMEI_5116 - hypothetical protein (Protein is coded in complementary strand; from 5349210 to 5348746)