Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5435676
End position: 5435705
Length: 30

DNA sequence
>NC_018289, from 5435676 to 5435705 (30 bp); Mycobacterium smegmatis str. MC2 155 TCGGTGTCTGTGTCGGTATCCGTGTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5435442-5436887	Sequence	MSMEI_5204 - pe-PPE, C-terminal domain protein (Protein is coded in complementary strand; from 5436887 to 5435442)