Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5558158
End position: 5558187
Length: 30

DNA sequence
>NC_018289, from 5558158 to 5558187 (30 bp); Mycobacterium smegmatis str. MC2 155 GCCGTCGCCCGCAGACGCCCGACGTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5556874-5558649	Sequence	MSMEI_5323 gabP GabA permease (Gamma-aminobutyrate permease) GabP