Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6691381
End position: 6691410
Length: 30

DNA sequence
>NC_018289, from 6691381 to 6691410 (30 bp); Mycobacterium smegmatis str. MC2 155 GCGATTCGGGCCGATACGGGGCGATCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6689159-6691441	Sequence	MSMEI_6460 metE 5-methyltetrahydropteroyltriglutamate/homocysteine S-methyltransferase (Protein is coded in complementary strand; from 6691441 to 6689159)