Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1033384
End position: 1033419
Length: 36

DNA sequence
>NC_018289, from 1033384 to 1033419 (36 bp); Mycobacterium smegmatis str. MC2 155 CCGACAAGTCGGACAAGTCCGACAAGGCCGACAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1032928-1034859	Sequence	MSMEI_0929 - Uroporphyrin-III C-methyltransferase/uroporphyrinogen-III synthase