Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1253865
End position: 1253900
Length: 36

DNA sequence
>NC_018289, from 1253865 to 1253900 (36 bp); Mycobacterium smegmatis str. MC2 155 GTGGTCGGCGGAGTGGTTGACGGAGTGGTCGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1253466-1255373	Sequence	MSMEI_1156 - hypothetical protein (Protein is coded in complementary strand; from 1255373 to 1253466)