Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1721860
End position: 1721895
Length: 36

DNA sequence
>NC_018289, from 1721860 to 1721895 (36 bp); Mycobacterium smegmatis str. MC2 155 TGCTCGACTCCTTGCTCGACTCCTTGCTCGACGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1720875-1722044	Sequence	MSMEI_1590 - hypothetical protein (Protein is coded in complementary strand; from 1722044 to 1720875)