Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2009693
End position: 2009728
Length: 36

DNA sequence
>NC_018289, from 2009693 to 2009728 (36 bp); Mycobacterium smegmatis str. MC2 155 CGACTCCGGATGCGCCTCGGGATGCGACTCGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2009571-2011115	Sequence	MSMEI_1889 rhlE ATP-dependent RNA helicase (Protein is coded in complementary strand; from 2011115 to 2009571)