Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2644198
End position: 2644233
Length: 36

DNA sequence
>NC_018289, from 2644198 to 2644233 (36 bp); Mycobacterium smegmatis str. MC2 155 CGCCTCGGTCCCAGCGTCGGTCCCAGCGTCGGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2643692-2644240	Sequence	MSMEI_2497 - tetR family regulator (Protein is coded in complementary strand; from 2644240 to 2643692)