Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2902915
End position: 2902950
Length: 36

DNA sequence
>NC_018289, from 2902915 to 2902950 (36 bp); Mycobacterium smegmatis str. MC2 155 AACAAGGGCGGCAACAACCGCGGCAACAAGGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2900612-2903014	Sequence	MSMEI_2765 - RNA binding protein, contains S1 domain (putative transcriptional accessory protein, RNA binding)