Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3282847
End position: 3282882
Length: 36

DNA sequence
>NC_018289, from 3282847 to 3282882 (36 bp); Mycobacterium smegmatis str. MC2 155 CGAGCTGGACTCCGAGTTGGACTCCGAGTTGGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3282752-3284293	Sequence	MSMEI_3120 - hypothetical protein (Protein is coded in complementary strand; from 3284293 to 3282752)