Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3401877
End position: 3401912
Length: 36

DNA sequence
>NC_018289, from 3401877 to 3401912 (36 bp); Mycobacterium smegmatis str. MC2 155 AGTCCTCGCAGTCCTCGCAGTCCTCACAGTCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3401805-3403862	Sequence	MSMEI_3236 - ATP/GTP-binding protein