Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4586900
End position: 4586935
Length: 36

DNA sequence
>NC_018289, from 4586900 to 4586935 (36 bp); Mycobacterium smegmatis str. MC2 155 CGTCTCGCTCACTCTCTCGCTCACCGTCTCGCTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4585605-4586912	Sequence	MSMEI_4397 mbtG Lysine-N-oxygenase MbtG (Protein is coded in complementary strand; from 4586912 to 4585605)
ORF... 4586933-4591399	Sequence	MSMEI_4398 mbtF peptide synthetase mbtF (Protein is coded in complementary strand; from 4591399 to 4586933)