Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5114379
End position: 5114414
Length: 36

DNA sequence
>NC_018289, from 5114379 to 5114414 (36 bp); Mycobacterium smegmatis str. MC2 155 GTGGCCGTCTTGGTGACCGTCTTGGTGGCCGTCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5114371-5115195	Sequence	MSMEI_4887 - hypothetical protein (Protein is coded in complementary strand; from 5115195 to 5114371)