Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5344427
End position: 5344462
Length: 36

DNA sequence
>NC_018289, from 5344427 to 5344462 (36 bp); Mycobacterium smegmatis str. MC2 155 CAGGCCGAGGTTCCGGCCGAGGTTCAGGCCGAGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5344451-5345941	Sequence	MSMEI_5112 - hypothetical protein (Protein is coded in complementary strand; from 5345941 to 5344451)