Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5552448
End position: 5552483
Length: 36

DNA sequence
>NC_018289, from 5552448 to 5552483 (36 bp); Mycobacterium smegmatis str. MC2 155 TCATCGGCCTCGTCGCCGGCCTCGTCGCCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5551803-5552957	Sequence	MSMEI_5318 - hypothetical protein (Protein is coded in complementary strand; from 5552957 to 5551803)