Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6164122
End position: 6164157
Length: 36

DNA sequence
>NC_018289, from 6164122 to 6164157 (36 bp); Mycobacterium smegmatis str. MC2 155 GCCGGTTGGGGTGCGGGCTGGGGTGCCGGTTGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6163501-6165120	Sequence	MSMEI_5940 - hypothetical protein (Protein is coded in complementary strand; from 6165120 to 6163501)