Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 791964
End position: 791999
Length: 36

DNA sequence
>NC_018289, from 791964 to 791999 (36 bp); Mycobacterium smegmatis str. MC2 155 TCGACGTCGTGGACGACGTCGTGCTCGACGTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 791723-792199	Sequence	MSMEI_0684 - hypothetical protein (Protein is coded in complementary strand; from 792199 to 791723)