Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 852774
End position: 852809
Length: 36

DNA sequence
>NC_018289, from 852774 to 852809 (36 bp); Mycobacterium smegmatis str. MC2 155 CGGCCACCAGCACCGCCACCACCAGGGCCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 851240-852823	Sequence	MSMEI_0748 - Na+/H+ antiporter (Protein is coded in complementary strand; from 852823 to 851240)