Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2699287
End position: 2699328
Length: 42

DNA sequence
>NC_018289, from 2699287 to 2699328 (42 bp); Mycobacterium smegmatis str. MC2 155 CGAATGGTAGGCCCCGCGTGGTAGGCCCAGCATGGTAGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2698683-2699297	Sequence	MSMEI_2554 cobA Cob(I)alamin adenosyltransferase