Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2503377
End position: 2503421
Length: 45

DNA sequence
>NC_018289, from 2503377 to 2503421 (45 bp); Mycobacterium smegmatis str. MC2 155 GCTGCCCGTACTGGGGCTGCCCGTACTGGGGCTGCCCGTACTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2502884-2503726	Sequence	MSMEI_2359 - hypothetical protein (Protein is coded in complementary strand; from 2503726 to 2502884)