Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2785934
End position: 2785978
Length: 45

DNA sequence
>NC_018289, from 2785934 to 2785978 (45 bp); Mycobacterium smegmatis str. MC2 155 CGACCACCACGCCCGCGACCACCACGGCCGCGACGACGACGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2785882-2786001	Sequence	MSMEI_2646 - hypothetical protein (Protein is coded in complementary strand; from 2786001 to 2785882)