Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2813273
End position: 2813317
Length: 45

DNA sequence
>NC_018289, from 2813273 to 2813317 (45 bp); Mycobacterium smegmatis str. MC2 155 ACGACGACGGCCCGCACGACGACGGTCCGCACGACGACCGTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2811806-2814241	Sequence	MSMEI_2672 - transmembrane alanine and glycine rich protein