Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6227970
End position: 6228014
Length: 45

DNA sequence
>NC_018289, from 6227970 to 6228014 (45 bp); Mycobacterium smegmatis str. MC2 155 AGGCCTTCTTGGCGGCGGCTTTCTTGGCGGGTGCCTTCTTGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6227969-6230779	Sequence	MSMEI_5999 topA DNA topoisomerase 1 (Protein is coded in complementary strand; from 6230779 to 6227969)