Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 781076
End position: 781120
Length: 45

DNA sequence
>NC_018289, from 781076 to 781120 (45 bp); Mycobacterium smegmatis str. MC2 155 GTGGTCGGCGGCGCCGTGGTGGTCGGCGCTGTGGTCGTCGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 780992-782779	Sequence	MSMEI_0675 - hypothetical protein (Protein is coded in complementary strand; from 782779 to 780992)