Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4342668
End position: 4342715
Length: 48

DNA sequence
>NC_018289, from 4342668 to 4342715 (48 bp); Mycobacterium smegmatis str. MC2 155 TTGTCCCAGTCGTTGTCCCGTTCGTTGTCCCAGTGGTTGTCCCGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4342392-4342832	Sequence	MSMEI_4157 - hypothetical protein (Protein is coded in complementary strand; from 4342832 to 4342392)