Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3683273
End position: 3683326
Length: 54

DNA sequence
>NC_018289, from 3683273 to 3683326 (54 bp); Mycobacterium smegmatis str. MC2 155 AGTGCGGGAGCCGGAGCAGGCGCGGGAGCCGGAGCAGGCGCGGGAGCCGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3682457-3683518	Sequence	MSMEI_3533 - Fibronectin-attachment family protein (Protein is coded in complementary strand; from 3683518 to 3682457)