Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4874616
End position: 4874669
Length: 54

DNA sequence
>NC_018289, from 4874616 to 4874669 (54 bp); Mycobacterium smegmatis str. MC2 155 GCTTCGGTGTCCTCGGCGGCTTCGGTGTCTTCGGTGTCTTCGGCGTTCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4874049-4874993	Sequence	MSMEI_4649 - membrane protein (Protein is coded in complementary strand; from 4874993 to 4874049)