Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5673698
End position: 5673751
Length: 54

DNA sequence
>NC_018289, from 5673698 to 5673751 (54 bp); Mycobacterium smegmatis str. MC2 155 ACTCAGGTTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5672893-5674788	Sequence	MSMEI_5434 - HNH endonuclease (Protein is coded in complementary strand; from 5674788 to 5672893)