Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 781136
End position: 781198
Length: 63

DNA sequence
>NC_018289, from 781136 to 781198 (63 bp); Mycobacterium smegmatis str. MC2 155 GTCGTCGTCGGTGTGGTCGTGGTGGTGGTCGTCGTGGTCGTGGTGGTCGTCGTCGTGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 780992-782779	Sequence	MSMEI_0675 - hypothetical protein (Protein is coded in complementary strand; from 782779 to 780992)