Sequence retrieval

Genome: Phaeobacter gallaeciensis DSM 17395
Start position: 2595820
End position: 2595846
Length: 27

DNA sequence
>NC_018290, from 2595820 to 2595846 (27 bp); Phaeobacter gallaeciensis DSM 17395 CATGCCGCCCATGCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2595815-2597467	Sequence	PGA1_c24920 groL 60 kDa chaperonin (Protein is coded in complementary strand; from 2597467 to 2595815)