Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1120715
End position: 1120738
Length: 24

DNA sequence
>NC_018513, from 1120715 to 1120738 (24 bp); Burkholderia cepacia GG4 CGCGAGCGCGCGCGCGATCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1120446-1121225	Sequence	GEM_1021 - amino acid ABC transporter ATPase (Protein is coded in complementary strand; from 1121225 to 1120446)