Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1187183
End position: 1187206
Length: 24

DNA sequence
>NC_018513, from 1187183 to 1187206 (24 bp); Burkholderia cepacia GG4 CGCCGCAGCCGCCGTCGCTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1183893-1189082	Sequence	GEM_1085 - DNA translocase FtsK (Protein is coded in complementary strand; from 1189082 to 1183893)