Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1231028
End position: 1231051
Length: 24

DNA sequence
>NC_018513, from 1231028 to 1231051 (24 bp); Burkholderia cepacia GG4 CGGCGTCGACGTCGTCGTCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1230877-1233726	Sequence	GEM_1126 - osmosensitive K+ channel signal transduction histidine kinase