Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1820398
End position: 1820421
Length: 24

DNA sequence
>NC_018513, from 1820398 to 1820421 (24 bp); Burkholderia cepacia GG4 GGCGGCGGCCGCGGCGCCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1819433-1820542	Sequence	GEM_1674 - RND family efflux transporter MFP subunit (Protein is coded in complementary strand; from 1820542 to 1819433)